Alunas: Amanda Soares 09/0002776



Baixar 54.04 Kb.
Encontro31.07.2016
Tamanho54.04 Kb.
Genética Forense

e a


Técnica do PCR

Universidade de Brasília

Alunas: Amanda Soares - 09/0002776

Carolina Fumico - 09/0004434

Inaê Aquino - 09/0018516

Luana Lima - 09/0028210

Paula Margotto - 09/0011872

Disciplina: Genética Básica

Professora: Zulmira Guerrero Marques Lacava

Introdução

A Biologia é uma ciência composta por inúmeras áreas, uma delas é a genética forense. Do inglês, forensic science é um termo utilizado, predominantemente, no uso da ciência e da tecnologia para a reconstituição e obtenção de provas de crimes. Esse ramo foi consolidado com o trabalho desenvolvido por Jeffreys, em 1985, que possibilitou a individualização do DNA.

O presente trabalho tem como finalidade de abordar técnicas de análise de DNA e suas aplicações. Dentre as técnicas destacam-se: reação em cadeia da polimerase (PCR), polimorfismo de comprimento de fragmento de restrição (RFLP), VNTR e STR e por fim a eletroforese em gel. A grande aplicação desse importante ramo da genética é a identificação de indivíduos a serviço da justiça como no teste de paternidade e identificação de suspeitos.


Genética Forense

Histórico

“Os testes de DNA são para a justiça o que o telescópio é para as estrelas: não uma lição de bioquímica, não uma exibição das maravilhas da lente de aumento, mas uma maneira de ver as coisas como realmente são”. Esta frase encontra-se no livro Actual Innocence de Scheck e Nefeuld e demostra como a Genética Forense que tem como base técnicas de análise da estrutura do DNA pode ser útil e esclarecedora. Para este ramo da Genética chegar onde está hoje com todas as suas técnicas um longo caminho para desenvolvê-las foi percorrido.


Até a década de 1980 quando desejava-se amplificar um trecho da molécula de DNA os cientistas lançavam mão de uma tecnologia desenvolvida por Cohen e Boyer que nada mais era do que um recurso de clonagem molecular. Neste método primeiro isolava-se o trecho de DNA em foco a ser amplificado utilizando enzimas de restrição. Estas enzimas também chamadas de endonuclease de restrição têm origem de procariotos e atuam como "tesouras moleculares", reconhecendo seqüências de pares de bases específicas em moléculas de DNA e cortando-as nesses pontos.
Depois de isolar o trecho desejado este é inserido no plasmídeo de alguma bactéria que teve de ser cortado e aberto em algum ponto para que a inserção pudesse ser realizada. Este plasmídeo modificado ou DNA recombinante é colocado dentro de uma célula bacteriana e esta ao se duplicar replicará o próprio material genético e conseqüentemente o segmento de DNA inserido. Assim, esperava-se que essas bactérias se multiplicassem suficiente para obter uma quantidade razoável do trecho desejado. Purificava-se tal segmento separando-o da massa total de DNA da população de bactérias formada.
Este procedimento era muito trabalhoso e demorado, pois além do inconveniente de ter de lidar com bactérias levavam-se dias para conseguir bastante DNA amplificado. Quando o PCR (Reação da Polimerase em Cadeia) foi inventado causou uma revolução no mundo científico e um grande avanço, porque em poucas horas alcançava-se o mesmo fim (amplificação seletiva de um trecho de DNA). Tal invenção valeu o prêmio Nobel, em 1993, a Kary Mullis.



Nesta época a tecnologia forense passou a ser aplicada cada vez mais freqüentemente e erros se tornaram comuns em identificação genômica. Com isto, órgãos de segurança pública contestaram o método empregado nas identificações. Na época o mais utilizado era a análise por meio dos Polimorfismos de Comprimento dos Fragmentos de Restrição (RFLP). É uma técnica na qual organismos podem ser diferenciados por padrões de DNAs clivados. Se dois organismos diferirem na distância entre os sítios de clivagem de uma endonuclease de restrição, o comprimento dos fragmentos produzidos vai diferir quando o DNA for digerido com uma enzima de restrição. Acontece que a avaliação das faixas de DNA eram muito subjetivas e difíceis de interpretar. Assim, um novo tipo de marcador passou a ser utilizado: o STR (repetições curtas enfileiradas)e é o mais empregado atualmente. Neste o tamanho medido do trecho é mais preciso.
Alguns casos de identificação humana ficaram famosos na história pela repercussão pública que tiveram. Citar-se-á dois deles. O primeiro se deu na Rússia com a tentativa de provar que resquícios esqueletais achados eram de indivíduos da família Romanov. Os ossos foram enviados ao Serviço de Ciência Forense que foi o primeiro laboratório do Reino Unido especializado em identificação genômica. Lá o cientista Gill desenvolveu um método de identificação com DNA mitocondrial (DNAm ) que é mais abundante que o cromossômico do núcleo celular. Conseguiu-se provar por meio de comparações de impressões genômicas simétricas que os ossos pertenceram a três irmãs, dois parentes e ao próprio czar Romanov.
O caso envolvendo o ex-presidente norte-americano Thomas Jefferson também tornou-se conhecido. Havia uma forte suspeita devido a semelhanças físicas de que Thomas era o pai de um ou dois filhos de uma escrava dele: Sally Hemings. Afim de esclarecer tudo o DNA foi fadado a resolver a questão. Amostras de DNA de descendentes masculinos do tio paterno de Thomas foram comparadas com amostras de descendentes masculinos de Tom e Eston (os filhos de Sally). Um traço jeffersoniano foi encontrado em ambas as amostras, mas isto confirma que o ex-presidente tenha tido um caso com a escrava, pois nada prova que um outro membro da famíla Jefferson pudesse estar envolvido.
A identificação genômica deu um grande salto com a invenção da técnica do DNA fingerprinting cujo autor foi Jeffreys. Ele trabalhava estudando genes da mioglobina quando percebeu que um pequeno trecho de DNA se repetia continuamente. Ampliando seus estudos Jeffreys percebeu que aquele tipo de trecho encontrava-se espalhado por todo o genoma . Ele descobriu acidentalmente como distinguir indivíduos. Uma amostra purificada da sequencia repetitiva foi marcada com molécula radioativa funcionando assim como uma sonda. Quando o genoma é colocado junto a sonda ocorre emparelhamento de base em certas regiões. Isto pode ser revelado com raios x e comparado com a seqüência de DNA pertencente a outro indivíduo possibilitando assim a identificação de indivíduos distintos.
A Genética Forense trata da utilização do conhecimento e das técnicas de genética e de biologia molecular no auxílio à justiça. Também é conhecido como DNA forense. Apesar do ramo mais desenvolvido da genética forense ser a identificação humana pelo DNA e sua aplicação mais popular o teste de paternidade, esta também pode ser aplicada na identificação ou individualização de animais, plantas e microorganismos presentes em resíduos, provas ou até mesmo no corpo de um cadáver.
Algumas etapas são importantes na coleta dos vestígios na cena do crime para uma conservação do material evitando a contaminação deste e um resultado incorreto da análise. Primeiro isola-se o local e toma os cuidados necessários para a preservação deste que varia de lugar para lugar. Antes de se fazer a coleta do material é importante fazer o reconhecimento e a identificação do material, seguido de um registro fotográfico, topográfico e descritivo. Esses registros são importantes para comprovação dos vestígios encontrados no local. E por fim faz-se a coleta com um transporte adequado até um laboratório aonde irá se fazer a análise laboratorial.
O material biológico pode variar entre sangue e um fio de cabelo. É apartir desse material que faz a extração do DNA e sua análise. Outros exemplos de amostra são dente, osso, tecido, sêmen, saliva e urina.
As técnicas que podem ser feitas as análises do material são o polimorfismo de comprimento de fragmentos de restrição (PCFR) ou do inglês, restriction fragment lenght polymorphisms (RFLP). A técnica consiste em detectar diferentes polimorfismos. Existem variações nas seqüências dos seus nucleotídeos que correspondem a mudanças neutras ou silenciosas, chamados polimorfismos de DNA. Esses polimorfismos podem ser detectados com base em diferenças no comprimento de fragmentos de DNA, produzidos pela clivagem com enzimas de restrição, que cortam o DNA em seqüências reconhecidas por essas enzimas. Tais seqüências são chamadas sítios de restrição que leva a formação de polimorfismos de comprimento de restrição.
Um exemplo é a enzima EcoR1 que reconhece a seqüência de DNA GAATTC. Se esta enzima estiver atuando em um filamento de DNA, toda vez, que a enzima encontrar essa seqüência ela corta o DNA entre G e A, produzindo fragmentos de restrição de DNA.

Na figura acima, observa-se a detecção do DNA e a clivagem do DNA pela enzima de restrição EcoR1. Em ‘B’, a enzima cliva três seqüências, produzindo dois fragmentos menores. Em ‘A’ a seqüência GAATTT não pode ser clivada pela enzima, produzindo um filamento único mais longo.
Conclui-se que variações nas seqüências de DNA em sítios de restrição específicos produzem variações nos comprimentos dos fragmentos de DNA, que são separados por eletroforese em gel e visualizados com o uso de sondas conhecidas e marcadas, geralmente radioativamente.
O PCFR foi uma das primeiras aplicações de análise de DNA para investigação forense. Com o desenvolvimento de técnicas de análise de DNA mais eficientes, o PCFR não é usado tanto como antes, pois requer quantidades relativamente grandes de DNA. Além disso, amostras degradadas por fatores ambientais como sujeira ou mofo, não funcionam bem com o PCFR.
A técnica que utiliza o DNA mitocondrial pode ser usado para examinar o DNA de amostras que não podem ser analisadas pelo PCFR, PCR, STR. Nessa análise utiliza-se o DNA extraído da mitocôndria. É usado em casos em que a amostra biológica é anucleada como cabelo, dente, etc.
A Análise do cromossomo Y é baseada no principio que o cromossomo Y é transmitido diretamente de pai para filho, assim a análise de marcadores genéticos do cromossomo Y é especialmente útil para rastrear as relações entre homens ou para análise de evidências biológicas que envolvem vários participantes do sexo masculino.
A Análise STR é uma tecnologia utilizada para avaliar determinadas regiões do DNA nuclear. Variabilidade nas regiões STR pode ser usada para distinguir um perfil de DNA apartir de outro.
O PCR é uma das tecnologias mais usadas ultimamente.
PCR é uma técnica da biologia molecular que permite a replicação em vitro do DNA. Essa rápida amplificação de material genético permitiu uma melhor analise do DNA em investigações criminais (onde vestígios podem ser mínimos) e em diagnósticos médicos mais precisos de doenças.
O DNA é previamente cortado por enzimas de restrição, que limita a área a ser replicada. A replicação será mais limitada ainda pelos primers na segunda fase do PCR.
O PCR consiste em três fases,que acontecem em um termociclador ,que controla automaticamente a temperatura do processo
Primeiro passo: desnaturação, consiste na separação das fitas duplas. Com o aumento da temperatura as ligações de hidrogênio que une as duas fitas são quebradas. As ligações de hidrogênio são mais fracas que as ligações covalentes entre a pentose e o fosfato, que permanecem intactas.

Segundo passo: hibridização, objetivo do PCR não é replicar todo DNA, mas uma pequena seqüência de interesse. Os primers são seqüências sintéticas de nucleotídeos que se ligam a seqüência complementar na fita molde. São adicionados dois primers, um para cada fita simples. A temperatura é aumentada para que os primers possam se encaixar com a fita simples.



Terceiro passo extensão: pela ação da enzima Taq polimerase os nucleotídeos complementares a fita molde são adicionados da 5’ para 3’.A vantagem da taq polimerase é que ela trabalha a temperaturas altas sem ser desnaturada.
E assim acontece sucessivamente nas fitas que crescem de forma exponencial

Eletroforese

A técnica de separação dos fragmentos de DNA mais utilizada é a eletroforese através de gel.A Eletroforese que forma padrão de bandas características para cada indivíduo ,isso permite a identificação de pessoas como em cenas de crimes e em testes de paternidade, como também diagnósticos de doenças específicas. Eletroforese é uma ferramenta amplamente utilizada no meio científico, é uma técnica baseada na separação de partículas em um determinado gel de acordo com os diferentes tamanhos cargas ou conformações. O princípio da eletroforese utilizada para separação de DNA se baseia na carga negativa global de uma fita de DNA. Ao final do processo as cadeias de DNA estarão próximas ao catodo (positivo), que atrai, devido à polaridade, moléculas de carga negativa. O DNA é colocado no gel ,que separa as partes mais pesadas das mais leves.
O gel é composto geralmente de agarose (um polissacarídeo extraído de uma alga marinha, é fácil de preparar e não é tóxico). Após a eletroforese , os fragmentos de DNA normalmente são corados com brometo de etídeo, que possui afinidade pelo DNA e fluorece (torna-se visível) vivamente em contato com a luz ultravioleta. Dessa forma pode-se localizar as bandas que correspondem ao DNA. Os fragmentos de DNA podem, então, ser isolados, purificados e analisados.

DNA satélite


DNA´s satélites são seqüências repetitivas (em tandem) e não codificadoras de DNA, que se localizam principalmente no centrômero e telômero dos cromossomos, exercendo funções estruturais nos mesmos. Exemplo: GACGATGCGAATGCGAGCTCTCTCTCTTCTCTCTCTC
Em 1960 foi descoberto o DNA satélite e atribuiu-se essa denominação por causa ao padrão de banda originado pela centrifugação em gradientes de densidade de CsCl (com o objetivo de separar o DNA por sua densidade), assemelhando-se a satélites orbitando ao redor de um corpo.

Cerca de 3 a 10% do genoma humano é composto por essas sequências e embora ainda não se saiba ao certo a origem dos DNA´s satélites, a teoria mais provável é a de que eles são formados pelas derrapagens (slippage) da DNA polimerase durante a replicação do DNA. Nesse processo, o número de repetições pode ser aumentado ou diminuído, caracterizando assim, uma diversidade de sequências.


Dentre os tipos de Satélites podemos destacar o DNA satélite (170-175 pares de base), o minissatélite ou VNTR- variable number of tandem repeats (10 a 15 pb) e o microssatélite ou STR-short tandem repeats (1 a 4 pb), sendo esse dois últimos de fundamental importância para a genética forense.
Uma grave doença neuromuscular causada pela expansão de microssatélites é a distrofia miotônica, também conhecida como doença de Steinert. Seu principal sintoma é a miotonia, ou seja, demora ao relaxar o músculo depois de contraí-lo. Ela é caracterizada por causar fraqueza muscular e problemas cardíacos, neurológicos e gastrointestinais. Seus sintomas podem ser amenizados por uma intensa fisioterapia.
No ano de 1985, Alec. J. Jeffreys, observou que o número de repetições de um dado minissatélite é diferente entre os indivíduos, o que dá origem a diversos alelos e conseqüentemente ao polimorfismo. Desse modo, é improvável que duas pessoas tenham o mesmo genótipo, com exceção de gêmeos monozigóticos. Pela técnica do PCR, uma determinada quantidade de DNA pode ser amplificada e analisada pela eletroforese em gel para a identificação de indivíduos e suspeitos e para testes de paternidade.

Aplicações:


  1. Identificação de suspeitos

As investigações policiais fazem o uso de comparações entre impressões digitais genéticas (DNA fingerprint) no reconhecimento de um criminoso. Como explicado anteriormente, cada indivíduo possui um número de repetições específicas de minissatélite, da mesma forma que cada um possui uma impressão digital distinta, por isso faz-se a analogia com o termo fingerprint. Após a coleta do material envolvido no crime e posterior movimentação desse ao longo do gel de agarose, compara-se os padrões de banda formados, como por exemplo na figura abaixo:



Percebe-se que o padrão de bandas da amostra de DNA encontrada na vítima é compatível com as bandas do suspeito 1. Dessa forma conclui-se que ele é o culpado pelo crime.
2- Teste de paternidade
O teste de paternidade é comumente utilizado para identificação e, portanto confirmações de suspeitas de paternidade. Muito usado como provas nos tribunais, apoiando a justiça de todo o mundo, e ainda como uma prova com uma probabilidade de erro extremamente mínima.
Consiste em comparar a impressão digital genética ou DNA fingerprint da mãe, do (a) filho (a) e do suposto pai, nos casos mais comuns. Com todas essas informações, tem-se os alelos doados pela mãe no DNA do(a) filho(a) e obrigatoriamente os outros foram doados pelo pai, assim, se o DNA do suposto pai tiver esses alelos, confirma-se a paternidade, do contrário, o teste de paternidade dá negativo.
Nesse processo de comparação, analisam-se vários genes, a quantidade e quais genes serão analisados no DNA da pessoa, varia de laboratório para laboratório. O Brasil é pioneiro nas análises utilizando-se a marcação por sondas radioativas dos Shorts Tandem Repeats ou STRs (pequenas repetições hipervariáveis de indivíduo para indivíduo).
O teste de paternidade pode ser feito ainda antes do nascimento da criança, nesse caso, colhe-se com uma seringa especial o líquido amniótico que contêm células com o DNA do feto. Essa especialidade do teste de paternidade é denominada paternidade pré-natal.
Há casos em que o suposto pai já faleceu, podendo-se com determinação judicial fazer a exumação do cadáver para obtenção do material genético ou utilização de material recolhido para biopsia num procedimento médico feito no corpo do suposto pai.
Também pode-se ter casos em que não se tem disponível o material genético do suposto pai e utiliza-se o do parentes deste para fazer uma prévia do que seria o DNA desse indivíduo. Ou não tem o material genético da mãe, fazendo a probabilidade matemática diferenciada no teste de paternidade.
A foto abaixo mostra como é feita essa comparação com as impressões digitais:

3- Teste de maternidade


Assim como no teste de paternidade sem o DNA da mãe, o teste de maternidade é feito com os mesmos princípios, porém a probabilidade matemática muda, já que na grande maioria dos casos também não se tem o DNA do pai.

Conclusão


A Genética forense se apoia nas técnicas desenvolvidas na genética e biologia molecular para auxiliar a justiça. Essas tecnologias foram sendo aprimoradas e hoje com uma quantidade bem menor de material genético que é extraído de uma amostra biológica pode ser feita uma análise bem precisa. Outro fator importante que contribui para a precisão da análise é a conservação da amostra, que envolve desde o processo de coleta dessa amostra até sua locomoção ao laboratório. Existem uma quantidade relativa de técnicas que podem ser aplicadas e o que vai direcionar qual a melhor tecnologia a ser adotada é a natureza da amostra.
O PCR é uma técnica da biologia molecular amplamente utilizada devido a sua eficácia na replicação em vitro do DNA, permitindo que de pequenas amostras se obtenha quantidade suficiente de DNA para analise. Essa técnica consiste em três etapas que ocorrem dentro de um termociclador (controla a temperatura durante o processo). Desnaturação, Hibridização e Extensão. Dobra-se a quantidade de DNA a cada ciclo.
Para a análise a técnica mais usada é a eletroforese, que utiliza diferença de potencial para separar o DNA de acordo com o tamanho e a densidade, formando fitas características.
Uma das técnicas mais usuais da genética forense é a do STR (microssatélite), que são curtas e repetitivas sequências de DNA, localizadas cromossomo, onde exercem funções estruturais. Há cerca de 25 anos descobriu-se que o número de repetições de um microssatélite ou minissatélite varia de indivíduo para indivíduo. Isso permitiu certas aplicações na justiça como a identificação de indivíduos e conseqüentemente de suspeitos. Desse modo, percebe-se a importância do desenvolvimento de estudos que aprimorem essa técnica.
Uma das aplicações mais usadas da genética forense é o teste de paternidade comparando-se impressões digitais utilizadas para identificação de indivíduos, e assim, confirmando-se ou não a paternidade do suposto pai. Esse teste auxilia muito decisões judiciais em tribunais de todo o mundo. O teste de maternidade, não tão comum, possui o mesmo princípio do teste de paternidade, exceto na probabilidade matemática.

Bibliografia


Bio – Volume Único, Sônia Lopes, Editora Saraiva http://www.scribd.com/doc/23337106/Aula-8-DNA-mitocondrial

http://www.roche.pt/portugal/index.cfm/produtos/equipamentos-de-diagnostico/products/molecular-diag/intro-pcr



http://www.abcdasaude.com.br/artigo.php?670

http://translate.google.com.br/translate?hl=pt-BR&sl=en&tl=pt&u=http%3A%2F%2Fwww.ornl.gov%2Fhgmis%2Felsi%2Fforensics.shtml

http://www.e-escola.pt/topico.asp?id=279

http://www.cremerj.com.br/palestras/624.PDF

http://www.cpafro.embrapa.br/media/arquivos/publicacoes/doc103_marcadoresmoleculares_.pdf
http://www.crbm1.gov.br/bio65/artigocien_65.asp
http://www.bombeiros.go.gov.br/trabalhos_cientificos/docs/Dissertacao-Monitoramento%20Genetico.pdf
http://bmg.fc.ul.pt/Disciplinas/FundBiolMolec/5Genoma%20II%20DNArepetitivo.pdf
http://br.answers.yahoo.com/question/index?qid=20070420160309AAab00B
http://webcache.googleusercontent.com/search?q=cache:0ICX2LNIRvcJ:www.portaldafisioterapia.com/%3Fpg%3Dfisioterapia_neurofuncional%26id%3D1126+distrofia+miot%C3%B4nica+caracteristicas&cd=9&hl=pt-BR&ct=clnk&gl=br
http://www.bombeiros.go.gov.br/trabalhos_cientificos/docs/Dissertacao-Monitoramento%20Genetico.pdf
http://webcache.googleusercontent.com/search?q=cache:rf3rFN94aVoJ:www.drashirleydecampos.com.br/noticias/1259+dna+satelite&cd=4&hl=pt-BR&ct=clnk&gl=br
http://forum.med.up.pt/viewtopic.php?t=92&sid=8385447c7243fca6a4929b411d721b84


©principo.org 2016
enviar mensagem

    Página principal